Alterations in Ruminal Micorflora of Steers Consuming Wheat Pasture Dosed with an Ionophore
S.C. Fernando, H.T. Purvis II, G.W. Horn, B.G. Feiser and U. DeSilva
Story in Brief
Twelve ruminally cannulated steers (510 ± 20 kg)
grazing wheat pasture (April 1 – April 20) were utilized to evaluate the
impact of ionophores on alterations in ruminal micoflora. Steers were randomly
assigned to three treatments (n = 4/treatment); Control (no ionophore),
Monensin (200 mg daily) or Lasalocid,
(200 mg daily). Three sampling periods were used to determine the alterations
due to ionophore dosing on microbial community; 1) before ionophore treatment
(BEFORE); 2) following 8 days of ionophore treatment (DURING), and 3) after
cessation of ionophore feeding (AFTER). Alteration in microbial diversity and
microbial numbers were evaluated using Terminal Restriction Fragment Length
Polymorphism (T-RFLP), and was analysed using Phylogenetic Analysis Tool (PAT).
During dosing of monensin, Gram positive bacterial numbers decreased from 39%
to 34% with respect to BEFORE and DURING bacterial numbers, and further
declined from 34% to 29.5% with respect to AFTER bacterial numbers. Dosing with
lasalocid decreased Gram positive bacterial numbers from 30.5% to 25% during
the treatment period, but remained constant from the DURING to AFTER period.
Overall, ionophore dosing altered the diversity of the microbial population in
the rumen. Additionally, there was an apparent reduction in the Gram-positive
bacteria in relation to total contribution to the total numbers. Additionally,
lasalocid appeared to alter microbial diversity more than monensin.
Keywords: Beef Steers, Ionophore, Rumen Microflora, T-RFLP, 16S rDNA
Introduction
Ionophore supplementation is an efficient management tool that improves weight gains of grazing beef cattle. It is believed that ionophores alter ruminal microflora via changes in the microbial membrane permeability’s to specific ions, thus altering various biological concentration gradients and selectively eliminating Gram-positive bacteria (Russell et al., 1987). These alterations in ruminal ecology impact fermented endproducts which are absorbed by beef cattle and ultimately impact animal metabolism (Bergen et al., 1984). The objective of this study was to evaluate the impact of ionophores on rumen microbial communities using T-RFLP and Phylongenetic Analysis.
Materials and Methods
Animals. Twelve
ruminally cannulated steers (510 ± 20 kg) were maintained at the wheat
pasture research facility located in
Treatments/Sampling Periods. Steers were assigned to one of three treatments; Control (no ionophore, n=4); Monensin (200 mg daily, n=4); or Lasalocid (200 mg daily, n=4). The ionophore was delivered daily via ruminal dosing at 0800 daily. Ruminal sampling was done before ionophore feeding (BEFORE, 4-1-2004), following 8 days of ionophore dosing (DURING, 4-9-2004), and 11 days after the cessation of ionophore dosing (AFTER, 4-20-2004). During each sampling time whole ruminal contents were removed at 0800 and 1300 for each steer. Samples (approximately 500 gm wet weight) were taken from the center of the ruminal mat and frozen immediately.
DNA Extraction. Frozen ruminal samples were thawed at room
temperature, and were homogenized using a food processor. Half gram of the
homogenized sample was used for genomic DNA extraction. DNA extraction was
carried out using Qiagen®
DNA stool Mini Kit according to manufactures protocols.
T-RFLP Analysis. The extracted DNA was quantified and was
diluted to 50 ng/μl and
was PCR amplified using fluorescently labeled universal 16S rDNA primers
(BAC08F AGAGTTTGATCCTGGCTCAG and BAC 805R GGACTACCAGGGTATCTAATCC). Resulting
PCR fragment was ethanol precipitated and was resuspended in 5 μl of sterile water. The PCR
product was then digested with Hae III, Msp I and Rsa I individually. The
restriction fragments generated were resolved using an ABI 377 DNA sequencer
and analyzed using GENESCAN software.
The GENESCAN analysis data was further analyzed using PAT
(Phylogenetic Analysis Tool) for assignment of species (http://trflp.limnology.wisc.edu/index.jsp);
(
Results and Discussion
Monensin. For steers dosed with monensin, Gram + bacterial numbers decreased from 39% to 34% with respect to BEFORE and DURING bacterial numbers (Table 1). Desulfobacterium sp., Escherichia coli, Paracoccus sp., and Rhodobacter sp. which were present in BEFORE were not detectable during Monensin dosing., but were, detectable again AFTER suggesting that these organisms may have been suppressed by monensin. Prevotella sp. (19%), Bacillus sp. (13%) and Xylella fastidiosa (8%) were predominant during supplementation of Monensin. Xylella fastidiosa, Vibrio sp. and Xanthomonas campestris levels increased from BEFORE to DURING and decreased by AFTER, suggesting that monensin may have induced the growth or removed other limiting factors that limited their contribution in terms of microbial numbers in a non-ionophore environment (Figure 1 and Appendix 1).
|
Table 1. Percentage of Gram + and Gram – Bacteria as Impacted by Monensin Dosed in the Rumen of Beef Steers Grazing Wheat Pasture |
|||
|
|
BEFORE* |
DURING† |
AFTER‡ |
|
Bacterial Type |
Percentage |
Percentage |
Percentage |
|
Gram+ |
38.69 |
34.07 |
29.57 |
|
Gram- |
61.31 |
65.93 |
70.43 |
|
* BEFORE – Before dosing with Monensin |
|||
|
† DURING – During dosing of Monensin |
|||
|
‡AFTER - After cessation of Monensin dosing |
|||
Figure 1. Bacterial fluctuations during
monensin treatment. The legend corresponding to each color is given below.
The percentages of each organism were calculated based on peak area.
Lasalocid. Treatment with lasalocid had the most drastic effect on the rumen microbial population diversity. During dosing with lasalocid Gram + bacterial numbers decreased from 30.5% to 25% during the treatment period, but remained constant from the DURING to AFTER period (Table 2). Similar to monensin, Prevotella sp. was predominant during lasalocid treatment and accounted for 36% of the diversity. Bacteroides sp., Clostredium sp., Flectobacillus major, Heliobacterium gestii, and Streptococcus sp. were predominant during supplementation of lasalocid and increased in numbers from BEFORE to DURING and decreased by AFTER, suggesting that lasalocid may have induced their growth or removed other inhibitory factors. During treatment of lasalocid, Desulfobacterium sp., Desulfobacter sp., Escherichia coli, Bradyrhizobium sp., Capnocytophaga sp., Gelidibacter algens, Methylosinus sp., Neisseria sp., Pseudomonas sp., Salmonella sp., and Ureaplasma urealyticum, which were present BEFORE, were not detectable during lasalocid dosing. However they were detectable AFTER (Table 2) suggesting that these organisms may have been suppressed by lasalocid. Furthermore, microbial numbers of Bacillus sp., Mycoplasma sp., and Nitrospira sp. were suppressed during lasalocid dosing in comparison to BEFORE and AFTER, but were at detectable levels (Figure 2 and Appendix 2.).
|
Table 2. Percentage of Gram + and Gram – Bacteria as Impacted by Lasalocid Dosed in the Rumen of Beef Steers Grazing Wheat Pasture. |
|||
|
|
BEFORE* |
DURING† |
AFTER‡ |
|
Bacterial Type |
Percentage |
Percentage |
Percentage |
|
Gram+ |
30.48 |
25.22 |
25.72 |
|
Gram- |
69.52 |
74.78 |
74.28 |
|
* BEFORE – Before dosing with Lasalocid |
|||
|
† DURING – During dosing of Lasalocid |
|||
|
‡ AFTER - After cessation of Lasalocid dosing |
|||
Figure 2. Bacterial fluctuations during
lasalocid treatment. The legend corresponding to each color is given below.
The percentages of each organism were calculated based on peak area.
Control
The control group of animals who were not dosed with an ionophore also showed some fluctuation of microbial diversity (Table 3) where, bacterial numbers of Bacillus sp., Clostredium sp., Mycoplasma sp., Prevotella sp., and Streptomyces sp. fluctuated. See Figure 3.
|
Table 3. Percentage of Gram + and Gram – Bacteria for Non-Dosed Beef Steers Grazing Wheat Pasture. |
|||
|
|
BEFORE |
DURING |
AFTER |
|
Bacterial Type |
Percentage |
Percentage |
Percentage |
|
Gram+ |
22.54 |
28.15 |
36.43 |
|
Gram- |
77.46 |
71.85 |
63.57 |
Figure 3. Bacterial fluctuations in control
animals. The legend corresponding to each color is given below. The
percentages of each organism were calculated based on peak area.
Overall the use of terminal restriction fragment length polymorphism and pylogenetic analysis appears to be good tools to monitor shifts in microbial communities in the rumen. Ionophore supplementation alters rumen microbial diversity greatly and these changes impact animal performance. The two most prevalent bacteria in terms of contribution to total detectable microbes during ionophore feed was Prevotella sp. and Bacteroides sp. Prevotella sp. which are mostly obligatory anaerobic, non-spore-forming, nonmotile, gram-negative, rod-shaped bacteria have the ability to ferment carbohydrates and produce succinic and acetic acids (Moore, et al. 1994). Bacteroides sp. produce several exoenzymes such as collagenase, neuraminidase, and DNAse. These anaerobic organisms are known to produce butyrate and acetate, and provide about 70% of the energy supply of the colonic enterocytes (http://www.anaesthetist.com/icu/infect/bacteria/anaerobe/bfrag.htm ). They are also known to ferment carbohydrates, utilize nitrogenous substances, and biotransformation of bile acids and other steroids (http://biology.kenyon.edu/Microbial_Biorealm/bacteria/bacteroidete_chlorob_group/bacteroides/bacteroides.htm). Additionally, it is interesting to note that while Gram + bacteria did decrease in numbers they still contributed to the total population during ionophore supplementation, suggesting that these particular Gram + bacteria are unaffected by these ionophores or have a mechanism(s) to adapt to the effects of the ionophore, in steers grazing wheat pasture.
Literature Cited
Kent, A.D. et al. 2003. Applied Environmental Microbiology. 69: 6768-6776
Moore, L.V. et al. 1994. International Journal of Systamatic Bacteriology. 44(4): 599-602
Russell, J.B. et al. 1987. Journal of
Animal Science. 64: 1519-25.
Copyright 2005 Oklahoma Agricultural Experiment Station
Authors
H. T. Purvis II – Associate Professor
G. W. Horn – Professor
B. G. Feiser - Graduate Student
DeSilva, U. – Assistant Professor